Centre of Bioinformatics Research & Technology
Advancing life sciences through bioinformatics and computational biology.
We analyze complex biological data, train the next generation of bioinformaticians, and build research capability for labs and biotech teams.
Upcoming cohorts
- NGS Data Analysis2 weeks · Live online · Mon–Fri3–17 Nov
- R for Bioinformatics2 weeks · Live online · Mon–Fri3–17 Nov
- Python & Biopython + R Internship1 month · Internship package19 Oct–17 Nov
- Fine Mapping & Candidate Gene Discovery10 days · Capstone projectComing soon
ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTC
Training
Live online courses & internships
Instructor-led cohorts in NGS, genomics, programming and drug discovery. Fees from ₹1,199 (Indian students) or USD 25 (international) for a one-week program.
Data analysis services
From FASTQ to biological insight
RNA-seq, WGS/WES, single-cell, metagenomics, protein modeling, docking and MD simulation — with code, figures and a full report.
Who we work with
Students
B.Sc., M.Sc., B.Tech., Pharma and PhD students building a first bioinformatics skill set.
Researchers
Scholars and postdocs who need a specific pipeline — WGS, GWAS, RNA-seq — working on their own data.
Labs & biotech
Teams that want analysis done: scoped, reproducible and delivered with code and figures.
Faculty & professionals
Teaching and industry professionals upskilling across bioinformatics domains.
ISO 9001:2015Certified quality management
1,100+Research news articles published
2,000+Learners trained
20+Countries our learners come from
Programs
Learn the workflows labs actually use
Foundations
Introduction to Bioinformatics
Programming
Python & Biopython for Bioinformatics
Programming
R for Bioinformatics
Genomics
NGS Data Analysis
Genomics
WGS & GWAS Data Analysis
Drug discovery
Bioinformatics & AI for Drug Discovery
Immunoinformatics
In Silico Vaccine Design
Internship
Project Internship in Human Genomics
Testimonials
What our learners say
★★★★★
“Tools and Techniques in Bioinformatics Training offered by CBIRT was a transformative experience!”
The hands-on sessions were particularly valuable, allowing me to apply theoretical knowledge in real-world scenarios, which has significantly enhanced my understanding of bioinformatics methodologies.
Anamika KumariMaster’s Student, Tel Aviv University, Israel
★★★★★
“I now feel more confident working with my own data generated from experiments!”
I also appreciated the hands-on training, where the instructor patiently guided us through every line of code. The course was beginner-friendly and covered all the basics in R, giving me a solid foundation.
Laura Machado CariasFifth-Year Undergraduate Student, Federal University of Viçosa, Brazil
★★★★★
“The NGS data analysis training I recently attended was an invaluable experience!”
This comprehensive curriculum covered all aspects of the NGS workflow, from the initial assessment of data quality to advanced analyses such as differential expression.
Karki DurgaM.Sc. Bioinformatics, Pokhara University, Nepal
★★★★★
“WGS data analysis training gave me the confidence to carry out the pipeline myself and also teach others!”
The class was conducted by a dedicated instructor and made the course easy for beginners and experts.
Cherisha RonneyPhD Research Scholar, Shiv Nadar University, Chennai
★★★★★
“Machine learning in bioinformatics course is very informative and engaging!”
I actually have fun studying, which I never expected to feel in an academic course.
Nakarin VutipowPhD Genetic Engineering & Bioinformatics, Kasetsart University, Thailand
Show more reviews
★★★★★
“The WGS Data Analysis training was an outstanding learning experience!”
Dr. Shikha Mittal’s teaching was exceptional—she explained complex concepts with such clarity and patience that even the most challenging topics felt manageable. I have never learned this much from any single workshop before!
Shanky JindalPhD Research Scholar, Guru Gobind Singh Indraprastha University, New Delhi
★★★★★
“The hands on approach was really helpful along with theory. Each session was engaging!”
The hands-on sessions, especially on protein classification and feature extraction, were incredibly insightful.
Nisha MamluskarM.Sc. Big Data Analytics, Jai Hind College, India
★★★★★
“The training Machine Learning in Bioinformatics was an excellent choice for me!”
The instructor Dr. Nadia was right to the point. I certainly recommended.
Arthur CentenoUTHSC, Tennessee, United States
★★★★★
“It was a positive learning experience!”
The instructors at CBIRT are highly professional yet remain humble and patient while addressing questions during the online sessions.
Dr. Lakshminarayanan KarthikUniversity of Madras, India
★★★★★
“It was fantastic and highly engaging. I thoroughly enjoyed it.”
The training was enjoyable, and I learned a lot, just as I expected. The instructor was highly competent.
Muhammad Rehman ShirzadTeaching Assistant and Ph.D. Scholar, The Pennsylvania State University, USA
★★★★★
“The WGS Data Analysis Training Course was an excellent learning experience!”
The practical exercises and real-world applications helped build my confidence in working with WGS data.
Ruchita TanuB.Tech. Biotechnology 4th Year, Amity University, Rajasthan, India
★★★★★
“Fantastic learning experience!”
The workshop provided a great blend of theoretical knowledge and hands-on training, helping me deepen my understanding of NGS techniques, Python, and Biopython.
Anantha LakshmiB.Sc. Biotechnology, St Francis College for Women, Hyderabad
Newsletter
Get new courses and research news in your inbox
Upcoming cohorts, internship openings and the week’s most important computational biology research. Unsubscribe anytime.
Start with a course, or send us your data.
We reply to every enquiry within 24 hours.